Guide: Dissertation: Een methode ontwikkelen en te optimaliseren om tonijnsoorten aan te tonen m.b.v. DNA analyse

Guide details:

  • Subject area(s): Dutch essays
  • Reading time: 24 minutes
  • Price: Free download
  • Published on: July 11, 2014
  • File format: Text
  • Number of pages: 2
  • Tags: Dutch
  • Dissertation: Een methode ontwikkelen en te optimaliseren om tonijnsoorten aan te tonen m.b.v. DNA analyse
    0.0 rating based on 12,345 ratings
    Overall rating: 0 out of 5 based on 0 reviews.

Text preview of this guide:

This page of the guide has 2177 words. Download the full version above.

1. Inleiding

1.1. Voorwoord
Voor het derde project in het eerste leerjaar van de opleiding BML, Biologie en medisch laboratoriumonderzoek, gaan wij als projectgroep een onderwerp uitdiepen en hier onderzoeken aan uitvoeren. De keuze ligt geheel bij ons en, met goedkeuring van de projectbegeleider, gaan onderzoeken hieraan verrichten, zowel op de literair als praktisch gebied.

Na een tijd van overleggen en verschillende onderwerpen te hebben behandeld, kwamen we uit op het onderzoeken van eiwitprofilering en/of DNA bij verschillende vleessoorten; een vrij algemeen en groot onderwerp maar wel erg actueel. De laatste tijd is er veel aandacht geweest voor fraude van vlees en de verkoop hiervan. Het d??nervlees is hier een voorbeeld van. Er wordt in het tweede leerjaar van Biologie en Medisch Laboratoriumonderzoek een experiment gebruikt waarbij wordt achterhaald welke soorten vlees in een genomen monster voorkomen. Dit experiment [1] wordt als gedeeltelijk uitgangspunt gebruikt voor dit onderzoek.

Echter moesten we ons gaan specialiseren op een bepaald onderwerp, aangezien vlees ‘in het algemeen’ een simpelweg t?? grote onderzoeksgroep is. Daarnaast kwam het feit dat dit experiment [1] al bestaat en we willen graag wat nieuws onderzoeken. Vrij snel kwam het onderwerp vis als uitgangspunt en hier was iedereen het mee eens. Is het mogelijk om te achterhalen welke vissoort er in een bepaald monster zitten?

1.2. Aanleiding
Op het moment is het testen van vlees erg in de spotlights. De vraag is vaak of het daadwerkelijk het vleessoort is wat op de verpakking wordt weergegeven. Aan vis wordt minder aandacht besteed, terwijl er sprake is van grote overbevissing op bepaalde vissoorten. Er wordt zelden getest of het vissoort op de verpakking daadwerkelijk die vissoort is en deze niet overbevist is. Vaak wordt het exacte soort vis niet eens weergegeven op de verpakking. Zo staat er op een blik tonijn dat het ‘tonijn’ is, terwijl veel soorten tonijn overbevist zijn en hierdoor niet verkocht mogen worden. Overbeviste soorten kunnen deel uit maken van een bijvangst en komen op deze manier toch op de markt. Volgens een artikel van ‘Trouw’ wordt er grootschalig gefraudeerd met de vangstcijfers van de bedreigde Blauwvintonijn. Ook meldt ‘Trouw’ dat de blikjes tonijn in Nederland voor 95% bestaan uit de gestreepte tonijn. Toch kunnen er in de blikjes de bedreigde Geelvin- en Grootoogtonijn aangetroffen worden. Deze tonijnsoorten maken namelijk deel uit van de bijvangst bij grootschalige vismethoden op de gestreepte tonijn. [2] Vanuit wetenschappelijk perspectief kan hier een interessant onderzoek uit voortvloeien. Wij willen m.b.v. het opzoeken van DNA sequensen, DNA isolatie, PCR en elektroforese zelf een methode ontwikkelen om aan de hand van de opbouw van DNA van het soort vis, in dit geval tonijn, vaststellen of dit tonijn is en welk soort dit is. Dit is mogelijk door de unieke basenvolgorden van tonijnsoorten op te zoeken en vervolgens hierop passende primers vinden. Eerst zal het DNA uit het vismonster ge??soleerd moeten worden. Daarna kan PCR worden toegepast om het DNA te repliceren. Uiteindelijk kan elektroforese worden toegepast om het DNA weer te geven. Hierna kan een conclusie worden uitgetrokken m.b.t. tot de vraagstelling: Is het onderzochte monster daadwerkelijk tonijn, en zo ja, van welk soort?

1.3. Probleemanalyse
Doordat er een aantal tonijnsoorten door overbevissing met uitsterven bedreigd worden, is er een visverbod op bepaalde tonijnsoorten, maar het is mogelijk dat deze soorten nog kunnen worden aangetroffen op de markt door grootschalige fraude met vangstcijfers . Er wordt weinig onderzoek gedaan naar het daadwerkelijke soort tonijn, daarom willen wij een DNA analyse doen op tonijn, gekocht in de supermarkt, en proberen vast te stellen of dit tonijn is en tot welke soort de gekochte tonijn behoort. Hiervoor zijn een aantal primers gekozen horende bij verschillende soorten tonijn waaronder de Grootoogtonijn, de Pacifische Blauwvintonijn, de Zuidelijke Blauwvintonijn en de geelvintonijn. Bij gebruik van deze primers bij PCR kunnen we tonijn en de bovenstaande tonijnsoorten detecteren door het gerepliceerde DNA te elektroforeren.

1.4. Doel
Het doel van dit onderzoek is: Een methode ontwikkelen voor het onderzoeken of een gekochte tonijn daadwerkelijk de soort tonijn is als dat beschreven wordt. Hierna word ook getracht te bepalen onder welke soort de onderzochte tonijn valt. Tenslotte wordt de methode, om te achterhalen welke tonijnsoort het is, geoptimaliseerd. ‘
2. Theoretische achtergrond
2.1. Tonijn en tonijnsoorten
De tonijn soorten die worden onderzocht zijn de blauwvintonijn (Thunnus maccoyii), Grootoogtonijn (Thunnus obesus), Pacifische blauwvintonijn (Thunnus orientalis) en de geelvintonijn (Thunnus albacares). Er is achtergrond grond over deze tonijn soorten verzameld, dit staat hieronder weergegeven.

2.1.1. Thunnus maccoyii
De zuidelijke blauwvintonijn (Thunnus maccoyii) is een straalvinnige vis uit de familie van makrelen (Scombridae) en behoort tot de orde van baarsachtigen (Perciformes). Het is de grootste tonijnsoort, de vis kan een lengte bereiken van 245 cm. . De vis prefereert een gematigd klimaat en leeft in de drie belangrijkste oceanen van de wereld Grote, Atlantische en Indische Oceaan. De diepteverspreiding is 50 tot ruim 2700 meter onder het wateroppervlak. Deze vis wordt vrijwel overal zwaar overbevist vanwege de hoge marktwaarde. Het is een van de duurste commerci??le vissoorten. Het is een belangrijk ingredi??nt voor Japanse sushi en sashimi. Daardoor is de populatie blauwvintonijn in de afgelopen 50 jaar met maar liefst 90 procent afgenomen. De vis behoort tot bedreigde diersoorten maar toch word de vis nog steeds gevangen omdat die niet op de CITES-lijst staat. CITES-lijst is een lijst met vissoorten waar niet meer op gevist mag worden wegens overbevissing. [3]

2.1.2. Thunnus albacares
De geelvintonijn (Thunnus albacares) is een straalvinnige vis uit de familie van makrelen (Scombridae) en behoort tot de orde van baarsachtigen (Perciformes). Hij leeft in de (sub)tropische delen van alle grote Oceanen. De diepteverspreiding is 1 tot 250 m onder het wateroppervlak. Het is een middelgrote tonijnsoort met een maximale lengte van 239 cm. Geelvintonijn zwemt vaak in gemengde scholen met andere tonijnsoorten en met zee- schildpadden. In vergelijking met andere tonijnsoorten wordt de geelvin vroeg volwassen, al vanaf het tweede levensjaar en bereikt een maximale leeftijd van 9 jaar. Geelvin wordt gevangen met ringzegen, kieuwnet en handlijnen. De geelvintonijn is voor de visserij van groot commercieel belang. Hij behoort niet tot overbeviste vissen en is daarom legaal om te vangen. [4]

2.1.3. Thunnus obesus
Grootoogtonijn (Thunnus obesus) leeft in de (sub)tropische delen van alle grote oceanen. Met een maximale lengte van 250 cm en het gewicht van maximaal 180 kg is grootoogtonijn een van de grotere tonijnen. De vis prefereert een subtropisch klimaat en leeft in de drie belangrijkste oceanen van de wereld, Grote, Atlantische en Indische Oceaan. De diepteverspreiding is 0 tot 250 m onder het wateroppervlak. De tonijn leeft in wateren met een temperatuur van 13 – 29 ??C met een optimum tussen de 17 en 22 ??C. Jonge grootoog zwemt in scholen, vaak gemengd met scholen van andere tonijnsoorten. Grootoog wordt vanaf het 4e jaar geslachtsrijp en kan 12 jaar oud worden. Overbevissing vormt een bedreiging voor deze vis. De enorme scholen tonijnen die ooit in de Noordzee leefden, zijn in de vorige eeuw door overbevissing uitgestorven. Ook de grootoogtonijn is ernstig overbevist en staat op de rode lijst van bedreigde diersoorten. Ook staat de tonijn op de CITES-lijst en is daardoor illegaal om te vissen. [5,6]

2.1.4. Thunnus orientalis
De Pacifische blauwvintonijn (Thunnus orientalis) is een roofzuchtige soort tonijn vond op grote schaal in de noordelijke Stille Oceaan maar is ook op sommige plaatsen in de zuidelijke stille oceaan te vinden. De diepteverspreiding is 0 tot 200 m onder het wateroppervlak. Pacifische blauwvintonijn is volgroeid op ongeveer 5 jaar oud, de maximale leeftijd die hij bereikt ligt tussen de 7 en 9 jaar. Hij word gemiddeld 2,6 meter lang, met een maximaal gewicht van 170 kg. Deze blauwvintonijn is zwaar overbevist maar staat nog niet op de CITES-lijst en is daarom nog legaal om op te vissen. Daardoor is de populatie blauwvintonijn in de afgelopen jaren met maar liefst 95 procent afgenomen. [7]
2.2. Deoxyribonucle??nezuur en primers
2.2.1. Deoxyribonucle??nezuur
DNA, voluit Deoxyribonucle??nezuur is de belangrijkste drager van erfelijke informatie. DNA bevindt zich in cellen in de vorm van chromosomen. DNA bestaat uit 2 lange strengen nucleotiden. Deze nucleotiden vormen samen en dubbelhelix. De tegenover elkaar liggende nucleotiden worden aan elkaar gekoppeld door basenparen. Er zijn 4 verschillende soorten nucleobasen: Adenine, Thymine, Guanine en Cytosine. Afgekort met de letters: A, T, G en C. Basen kunnen alleen in de paren AT en GC voorkomen. Een nucleotide bestaat uit een base, een deoxyribosegroep en een fosfaatgroep. [8]

De volgorde van nucleotiden in een streng wordt een sequentie genoemd. Er zijn zeer veel sequenties mogelijk, hierdoor kan de volgorde van nucleotiden unieke erfelijke informatie verstrekken. Zoals men met letters woorden maakt, met woorden zinnen en met zinnen boeken maakt. Zo worden de letters van het DNA (de nucleotiden) gebruikt om erfelijke informatie te coderen. [9]

Een stukje DNA kan als volgt worden genoteerd:
5”ATGGCTACCGTACAATAGGCATT -> 3′
3′ <- TATCCGGTAAGTGCGATTGGCT — 5′
Aan de 5′-zijde bevindt de fosfaatgroep in de nucleotide en aan de 3′-zijde de deoxyribosegroep. In de dubbelhelix is de richting van de streng altijd tegenovergesteld aan die van de andere streng. Dat betekend wanneer de ene streng met een 5′-zijde begint, begint de andere streng met een 3′-zijde. [10]

2.2.2. Primers
Bij PCR wordt gebruik gemaakt van primers. Een primer is een klein stukje DNA of RNA. Bij PCR wordt telkens gebruik gemaakt van 2 primers, namelijk de forward en reverse primer. De forwardprimer is de 5′-streng en de reverse de 3′-streng. Vanaf de plaatsing van de primer wordt het DNA richting 5′ gerepliceerd.
Over het algemeen bevat een primer tussen de 18 en 22 basenparen. Voor PCR kan het beste een primer worden gebruikt die bestaat uit een relatief korte streng, die uniek is voor het stukje DNA wat gedupliceerd moet worden. Indien dit niet het geval is kan het voorkomen dat de primer op andere plaatsen aan het DNA bindt en stukken gaat dupliceren waar dit niet de bedoeling is. Ook mag een primer geen doorlopend stuk bevatten met meer dan 3 op elkaar passende basenparen, omdat de primer anders kan dubbelvouwen en zo een dubbele streng met zichzelf vormt. Hierdoor kan de primer zich niet meer aan de te repliceren DNA streng binden. [11,12] Wanneer een primer past op het DNA van het te identificeren monster, kan het met behulp van PCR gerepliceerd worden en doormiddel van elektroforese zichtbaar worden gemaakt.

De volgende primers worden in het project gebruikt om verschillende tonijnsoorten te identificeren: [13]

Tabel 1: De verschillende tonijnsoorten, de Latijnse- en volledige naam, de bijbehorende primers (zowel de forward- als reverse primer) en het PCR product die bij de primer hoort.
Latijnse naamgeving: Volledige naam: Primer Forward (5’ ‘ 3’)
F = forward, R = Reverse Amplicon
Thunnus Obesus Grootoogtonijn (F) AGGCTTTTCAGTAGACAATGC
(R) TGGATTATTTGAACCTGTTTCG 127 bp
Thunnus Orientalis Pacifische Blauwvintonijn (F) CCCTCATCTCTGAAATCTAGTAAAC
(R) ACCTTCAATAACCGTATGCAT 82 bp
Thunnus Maccoyii Zuidelijke Blauwvintonijn (F) AAACATGAAACATCGGAGTAGTACTC
(R) CATATGGGACTGCGGATA 135 bp
Thunnus Albacares Geelvintonijn (F) CGAGGACTTTACTACGGCTCTT
(R) CGGTCATCATAACTAGGAGTAGGAGTAC 83 bp
Thunnus spp. Algemeen tonijn (F) TAGTATGGGCGACAGA
(R) CGTTCCCTTGCGGTACTTTC 63 bp

In de bovenstaande tabel worden tonijnsoorten weergegeven in Latijnse naamgeving en de volledige naam. De primers worden weergegeven in basenparen. Het amplicon is het PCR product. Dit houdt in hoeveel baseparen je na de PCR-reactie verkrijgt. Hoe hoger het amplicon des te langer het duurt voordat er bij elektroforese bandjes zichtbaar zijn. Een laag PCR-product is dus gewenst, zoals die in de bovenstaande tabel.
2.3. Polymerase Ketting Reactie (PCR)
De polymerase ketting reactie, in het kort PCR, is een zeer gevoelige techniek die in staat is om een zeer klein gedeelte van genomisch DNA of ‘?n afzonderlijk DNA-molecuul enorm te vermeerderen en daarmee dus aan te tonen. De PCR techniek kan op zeer veel gebieden worden toegepast bijvoorbeeld in de medische wetenschap om genetische afwijken in cellen aan te tonen, of om kleine hoeveelheden virussen of bacteri??n aan te tonen. PCR kan ook worden gebruikt om genetische verwantschappen aan te tonen op basis van overeenkomsten in het RNA of DNA.
Een nadeel van PCR is dat de reactie die plaats vind zeer gevoelig is voor verontreinigingen. Dit probleem is in de praktijk wel oplosbaar door zeer netjes te werken, met handschoenen aan en met gesteriliseerde materialen en oplossingen.

Het PCR apparaat is eigenlijk niets meer dan een heel nauwkeurig verwarmings- en koelapparaat met daarin de buisjes met het DNA-monster en andere ingredi??nten die noodzakelijk zijn voor de reactie. Deze ingredi??nten zijn:
– losse nucleotiden (A’s, T’s C’s and G’s),
– korte enkelstrengs DNA moleculen de zogenaamde primers
– Een enzym met de naam Thermus aquaticus polymerase (Taq polymerase).
Het proces bestaat op 3 stappen en is afgeleid van de manier waarop in de natuur DNA wordt vermeerderd. De eerste stap is een temperatuursverhoging tot ongeveer 90-95??C waardoor de waterstofbruggen tussen de DNA-strengen verbroken worden. Hierbij word van het aanwezige dubbelstrengs-DNA van het monster, enkelstrengs-DNA gemaakt.

Vervolgens worden er primers toegevoegd, die complementair zijn aan het eerste stukje van het te kopi??ren DNA. Deze primers zijn synthetische oligonucleotiden met een bekende sequentie van 15 ?? 30 nucleotiden. De temperatuur wordt verlaagd tot circa 60??C, zodat de primers zullen hybridiseren aan het DNA. Het DNA-polymerase kan echter pas starten wanneer er ergens een stukje dubbelstrengs-DNA met een vrije 3’-OH groep aanwezig is, dat is de reden dat er twee verschillende primers worden toegevoegd, ‘?n primer voor het begin en ‘?n primer voor het einde van de DNA steng.

Als laatste stap vindt de verlenging van deze primers door het enzym DNA-polymerase. Dit wordt de ‘extension’ of elongatie genoemd. Voor verlenging van het DNA wordt gebruik gemaakt van een thermostabiel DNA-polymerase met een optimumtemperatuur van 72??C. het polymerase ondervindt ook vrijwel geen schade van de denaturatietemperatuur van 94??C. Dit polymerase is ge??soleerd uit de bacterie thermus aquaticus die voorkomt in heetwaterbronnen in Yellowstone Park.

De eerste 3 stappen, samen een cyclus, worden weer herhaald. De nieuwe strengen worden nu ook als ‘template’ gebruikt voor de volgende stap. Uit ‘?n DNA-molecuul ontstaan na 1 cyclus 2 moleculen, vervolgens 4, daarna 8, ,16, 32 enzovoort. Er zijn ongeveer 25 cycli, van circa 4 minuten, nodig om tot 1 miljoen moleculen te komen. In de praktijk word gestart met ?? 1 ng DNA-template. [14,15]


3. Principe en methode
3.1. DNA isolatie uit visweefsel (eerste methode)
3.1.1. Principe experiment
De genetische informatie in eukaryote cellen bevindt zich voor 99% in de kernen. De isolatie van DNA uit kernen van visweefsel begint met een procedure om de kernen uit de cellen te verkrijgen. Dit gebeurt m.b.v. een isotone celhomogenisatie procedure, waarin de cellen kapot gaan en de kernen intact blijven. De kernen worden ge??soleerd d.m.v. centrifugatie. De activiteit van de DNA-endonucleasen worden geremd door toevoeging van citraat aan de homogenisatieoplossing. De activiteit moet geremd worden, omdat anders dit enzym het DNA afbreekt. De kernen zullen vervolgens na centrifugatie op de bodem van de centrifugebuis terecht komen terwijl de inhoud van de cellen (RNA, eiwitten, kleinere celorganellen, en andere moleculen oplosbaar in 0,15 M zout) in de bovenstaande vloeistof terecht zullen komen. M.b.v. een osmotische shock wordt het DNA-histon complex uit de kern ge??xtraheerd. Toevoeging van zout (2,5 M NaCl) aan de oplossing resulteert vervolgens in de dissociatie van het DNA-histon complex, waardoor het DNA en de histonen afzonderlijk in oplossing zijn. Het DNA wordt uiteindelijk van het eiwit gescheiden d.m.v. precipitatie van het DNA, m.b.v. ethanol. [12]

3.1.2. Methode experiment
Er wordt 5,00 g visweefsel afgewogen. Het weefsel wordt in ca. 75 mL koude 0,1 M NaCl/0,05 M Na-citraat gehomogeniseerd door gedurende 2 min te mixen in de Waring Blender. Het weefsel t verder gehomogeniseerd d.m.v. potteren in ijs. Het homogenaat wordt dan 10 min gecentrifugeerd bij 2600 rpm. Vervolgens t het supernatant en het laagje vet afgegoten en bij het sediment wordt 2 ml gekoelde buffer toegevoegd. De buis wordt na het vortexen verder aangevuld met de buffer en dan direct gecentrifugeerd gedurende 10 min bij 2600 rpm. Het supernatant wordt afgegoten en het sediment wordt opnieuw gecentrifugeerd alleen dan nu met demiwater i.p.v. buffer. Vervolgens wordt het sediment weer gepotterd met 30 ml demiwater. De oplossing wordt overgebracht in een bekerglas en er tt 4,15 g vast NaCl toegevoegd. Als laatste wordt er voorzichtig 60 mL ethanol 96% toegevoegd en m.b.v een glasstaaf kan het DNA om de roerstaaf gewonden worden. Het DNA wordt vervolgens in de droogstoof gedroogd.

3.2. DNA isolatie uit visweefsel (tweede methode)
3.2.1. Principe experiment
Om DNA-isolatie uit het vis monster uit te kunnen voeren moeten eerst de cellen kapot worden gemaakt m.b.v. een lyse-oplossing. Daarna moet je het monster verder kapot maken door te roeren. Daarna moet het kapotgemaakte monster worden gescheiden door te centrifugeren. Daarna moet het supernatant worden afgegoten en daarna word er een selica resin oplossing aan toegevoegd waar het DNA zich aan zal binden. Daarna moet er goed gehomogeniseerd worden zodat het DNA zich zal binden aan de oplossing. Hierna moet de stof in een waterbad gestopt worden zodat het DNA zich nog beter zal binden vanwege een betere temperatuur. Hierna moet opnieuw gecentrifugeerd worden zodat het DNA dat is gebonden aan de oplossing afgegoten kan worden. Hierna word een buffer toegevoegd zodat de DNA die aan de wand vast zit word afgespoeld en verzameld. Dit moet 2 keer gebeuren. Tussendoor moet opnieuw worden gehomogeniseerd en gecentrifugeerd. Hierna moet van de oplossing weer de supernatant afgegoten worden en daarna word er demiwater aan toegevoegd en nog een keer gehomogeniseerd. Daarna moet het monster worden geincubeerd zodat het DNA goed vrijkomt en de nucleasen worden permanent ge??nactiveerd. Hierna heb je het DNA gescheiden van het monster. [16]

3.2.2. Methode experiment
Door aan een kleine hoeveelheid monster (10 tot 20 mg), in iedere centrifugebuis, 300 ??L Lysis-oplossing toe te voegen. De Lysis-oplossing lost membranen op, waaronder het kernenvelop (nucleus), mitochondria en chloroplast. Hierdoor komt het DNA vrij in oplossing te liggen, wanneer de cellen verder kapot worden gemaakt. Dit gebeurt door meteen glasstaaf de inhoud in een centrifugebuis kapot maken. Hierna zou het monster opgelost moeten zijn. De buizen worden ge??ncubeerd in een waterbad op 65 ??C, gedurende 10 minuten. Hierna word gecentrifugeerd (1 min. & 2600rpm) zodat de vaste deeltjes in het pellet terechtkomen. Hiervan wordt 150 ??L supernatant overgebracht en hier word 3 ??L Silica resin bijgevoegd. Na homogenisatie wordt dit mengsel weer ge??ncubeerd op 57 ??C, gedurende 5 minuten. Hierna wordt de buis weer gecentrifugeerd (30 sec. & 2600 rpm). Verwijder al het supernatant uit de buis, m.b.v. een pipetman, om vervolgens 500 ??L ijskoude ‘Was buffer’ aan het pellet toe te voegen. Homogeniseer goed d.m.v. bijvoorbeeld vortexen. Hierna wordt er weer gecentrifugeerd (30 sec. & 2600 rpm), en verwijder hierna weer al het supernatant uit de buis met een pipetman. Voeg 100 ??L demiwater toe aan het pellet met ‘Silica resin’ en homogeniseer m.b.v. de vortex. Incubeer vervolgens de buis met inhoud in een waterbad op 57 ??C gedurende 5 minuten. Centrifugeer andermaal (30 sec. & 2600 rpm). Breng 90 ??L supernatant over in een nieuwe buis of container, en bewaar dit bij -20 ??C, mits alles correct is uitgevoerd bevat dit supernatant de DNA in oplossing.
3.3. Zuiverheid bepaling van ge??soleerd DNA uit visweefsel
3.3.1. Principe experiment
Voor het bepalen van de zuiverheid wordt een absorptie spectrum van het monster opgenomen. Nucle??nezuren hebben een absorptiemaximum bij 260 nm (UV gebied). Hoe zuiverder het DNA hoe smaller de absorptie piek. Eiwitten hebben een absorptiemaximum bij 280 nm. Wanneer het ge??soleerde DNA vervuild is met eiwitten, dan zal de piek van het absorptie spectrum verbreden. De zuiverheid van DNA wordt bepaald door de verhouding A260/A280 te meten. Voor zuiver DNA geldt dat deze ratio tussen de 1,8 en 2,0 ligt. . Wanneer een oplossing uit zuiver DNA bestaat dan is een absorptie bij 260 nm van 1 ongeveer gelijk aan een concentratie van 50 ??g/ml. [16]

3.3.2. Methode experiment
Er word 0,5 g visweefsel DNA opgelost in 100 ml demiwater. Vervolgens word een verdunning gemaakt in demiwater van 0,05 mg visweefsel DNA per ml. Het absorptiespectra word genomen van ?? = 230 tot 350 nm en de extinctie word gemeten bij E260, E280 en E320. De zuiverheid van het DNA kan nu bepaalt worden door E260/E280. Voor zuiver DNA geldt dat de ratio tussen de 1,8 en 2,0 ligt.
3.4. Polymerase Ketting Reactie (PCR)
3.4.1. Principe experiment
PCR is in staat om een zeer klein gedeelte van genomisch DNA of ‘?n afzonderlijk DNA-molecuul enorm te vermeerderen en daarmee dus aan te tonen. Het proces bestaat op 3 stappen, de eerste stap is een temperatuursverhoging tot ongeveer 90-95??C waardoor de waterstofbruggen tussen de DNA-strengen verbroken worden. Hierbij word van het dubbelstrengs-DNA, enkelstrengs-DNA gemaakt. Vervolgens worden er primers toegevoegd, die complementair zijn aan het eerste stukje van het te kopi??ren DNA. De temperatuur wordt verlaagd tot circa 60??C, zodat de primers zullen hybridiseren aan het DNA. Als laatste stap vindt de verlenging van deze primers door het enzym DNA-polymerase. De eerste 3 stappen, samen een cyclus, worden weer herhaald. Er zijn ongeveer 25 cycli, van circa 4 minuten, nodig om tot 1 miljoen moleculen te komen. [1,14]
3.4.2. Methode experiment
Het DNA, dat met de voorgaande experimenten is verkregen, kan in de PCR-methode worden gebruikt voor de elektroforese. De agarosegel met bandjes kan worden vergeleken met die van de bijbehorende primers (zie 3.4. PCR data-analyse). Indien er nog geen DNA ge??soleerd is, wordt 50 mL 10 mM Tris-oplossing als basis-oplossing gebruikt, hier wordt het te isoleren DNA-monster in opgelost. Vervolgens worden vijf primers gebruikt: ‘Grootoogtonijn’, ‘Pacifische Blauwvintonijn’, ‘Zuidelijke Blauwvintonijn’, ‘Geelvintonijn’ en die van ‘Algemeen tonijn’. Deze worden met een concentratie van 20 pmol primer per 50 ‘L PCR-oplossing in de Tris-oplossing opgelost. Vervolgens vinden er 25 cycli plaats m.b.v. de PCR BioRad-apparatuur. Er zullen drie fases plaatsvinden, achtereenvolgend; Het denatureren bij 94 ??C voor 0.5 minuten, annealing bij 60 ??C voor 0.5 minuten en de verlengfase bij 72 ??C voor 0.5 minuten. De omgeving moet voldoen aan een pH van 8.0, de concentratie aan Tris-acetaat zal 40 mM en die van EDTA 1 mM bedragen. Brengt vervolgens 8 ‘L PCR-oplossing aan op de agarosegel. Breng vervolgens aan op het BioRad-apparaat. Het elektroforeren kan nu beginnen bij 100 V gedurende 30 minuten. Ten slotte wordt er na afloop van de elektroforese een kleuring toegepast door middel van het toevoegen van ethidiumbromide (0,5 ‘g ‘ mL-1)
3.5. PCR data-analyse
Na de elektroforese word ethidiumbromide toegevoegd om de bandjes op de agarosegel zichtbaar te maken. Wanneer er geen bandjes op de agarosegel verschijn zal de Primer niet aan hebben geslagen. Dit kan veroorzaakt worden door: een verkeerde behandeling van het DNA v’?r het uitvoeren van PCR,
het DNA van het monster correspondeert niet met de Primers, een mogelijke te hoge of lage temperatuur bij de 3 fasen, of een te hoge of lage PH.’
4. Onderzoeksstrategie
4.1. Doel
Het doel van ons onderzoek is: Een methode ontwikkelen voor het onderzoeken of een gekochte tonijn daadwerkelijk tonijn is. Hierna word ook getracht te bepalen onder welke soort de onderzochte tonijn valt.

4.2. Onderbouwing
De strategie om dit doel te bereiken bestaat uit vier stappen en is als volgt:
4.2.1. Het verkrijgen van het DNA
Wij kopen zelf ‘?n of twee vismonsters om hieruit zelf het DNA te isoleren. Dit doen wij, omdat er niet altijd bekend is wat voor soort vis men koopt. Tonijn kan als andere vis worden verkocht en vice versa. De aanleiding voor dit onderzoek is om een methode te ontwikkelen om dit soort visfraude tegen te gaan. Dit zal met twee verschillende methodes gebeuren en beide worden in duplo gedaan i.v.m. de optimalisatie van de methode (zie 4.2.5. Optimaliseren van methode)
4.2.2. Zuiveren van het DNA
Wij zuiveren het DNA zelf, om onszelf te controleren. Is het DNA zuiver genoeg om PCR mee uit te voeren? Zo ja, gaan we verder met het onderzoek. Zo nee, herhalen van de DNA extractie & de zuivering.
4.2.3. Polymerase Ketting Reactie (PCR)
Wij gaan zelf PCR uitvoeren met zuiver ge??xtraheerd DNA. Het doel hiervan is om een DNA sequens te cre??ren m.b.v. PCR. Het PCR-proces bestaat uit ong. 40 cycli en er ontstaat een lange DNA keten die word gecre??erd m.b.v. primers (Forward & Reverse). Het resultaat wordt ge??nterpreteerd en uitgezet in een lange basenketen.
4.2.4. Bepaling vissoort
In de basenketen wordt gezocht naar een stuk dat identiek is voor tonijn ‘in het algemeen’. Vervolgens ook voor een stuk dat identiek is voor een specifieke tonijnsoort.
De referenties, of basenvolgordes die al bekend zijn, komen van een onderzoek van internet. [13] Is er overeenkomst gevonden tussen de gecre??erde DNA sequensen en de referentie sequensen, dan is er gelijktijdig een methode ontwikkeld voor het aantonen van vissoorten (binnen tonijn). Deze methode bestaat dan uit de 4 stappen die hier beschreven staan.
4.2.5. Optimaliseren van methode
Er worden verschillende methoden gebruikt om DNA te isoleren. De methode die het meest betrouwbare DNA geeft, en dus het meest zuivere DNA oplevert, zal worden beschouwd als de beste methode voor het isoleren van DNA. Het meest zuiver verkregen DNA zal worden gebruikt bij de PCR-methode.

4.3. Hypothese
Er wordt verwacht dat wij doormiddel van DNA isolatie, zuivering, PCR en elektroforese aan kunnen tonen dat het vlees in blikjes tonijn, tonijn is. Ook bestaat er een kans dat we een van de bedreigde soorten zoals de Blauwvintonijn, Geelvintonijn of de Grootoogtonijn zullen aantreffen. Voor deze bedreigde soorten zijn primers gevonden. Deze kans is echter erg klein, aangezien de blikjes tonijn voor 95% uit de Gestreepte Tonijn, die niet bedreigd is, zou bestaan. [2]
5. Planning
5.1. Activiteitentabel
Week Activiteit Waar Tijds-duur Deadline Wie
3.7 Werken aan het werkplan. Thuis 10-04
Verslag af Casper: Planning en MSDS
Jetze: Protocollen en Inleiding
Sanne: Methoden en Theorie PCR, Principes en protocollen
Hugo: Lay-out, bronvermelding en inhoudsopgave en protocollen
Iske: Aanleiding, probleemanalyse, theorie DNA en primers
3.8 Werken aan het werkplan zoals hierboven vermeld staat
11-04 ochtend controleren werkplan.
Digitaal inleveren. Thuis 11-04
Verslag inleveren Werken aan werkplan taken zoals hierboven: Casper, Jetze, Sanne, Hugo en Iske
Inleveren: Hugo
3.9 Als het plan is goedgekeurd, vindt een beoordelingsgesprek plaats.

Als het niet is goedgekeurd moet het plan worden bijgewerkt. Het beoordelingsgesprek vindt plaats op school. lokaal is onbekend.
Het werkplan bijwerken gebeurt thuis. 17-04
Beoordelings
gesprek Indien het werkplan verbeterd moet worden heeft ieder dezelfde taak als hierboven.

3.10 Was het plan afgekeurd dan werkplan inleveren en Beoordelingsgesprek

Experimenten voorbereiden Het beoordelingsgesprek en werkplan inleveren gebeuren beiden op school. lokaal is onbekend.
Voorbereiding op school Indien werkplan was afgekeurd inleveren:
21-04
25-04
Indien afgekeurd wordt het werkplan ingeleverd door Hugo
Stoffen bestellen: Hugo en Sanne
Controleren of apparatuur aanwezig is: Jetze en Iske
VAK Vakantie – –
4.1 Uitvoeren van experiment
DNA isolatie 1 & 2 Lokaal S339 9-04
Project dag Experiment 1: Hugo, Casper en Jetze
Experiment 2: Sanne en Iske
4.2 Uitvoeren van experiment
DNA zuivering duplo
Indien tijd over beginnen met PCR in duplo Lokaal S339 16-04
Project dag Duplo 1: Hugo en Sanne
Duplo 2: Jetze, Casper en Iske
Duplo 1: Hugo, Iske en Casper
Duplo 2: Sanne en Jetze
4.3 Uitvoeren van experiment PCR en
Elektroforese met meest zuivere DNA in duplo en analyse Lokaal S339 23-04
Project dag Duplo 1: Hugo, Iske en Casper
Duplo 2: Sanne en Jetze
4.4 Verwerken resultaten School

30-04 Alle experimenten gezamenlijk

4.5 Experimenten die niet gelukt zijn inhalen
Verwerken resultaten en maken verslag Lokaal S339

School 6-06
Project dag
Duplo 1: Hugo, Iske en Casper
Duplo 2: Sanne en Jetze
Gezamenlijk
4.6 Maken verslag en posterpresentatie Thuis of op school 11-06
Verslag en poster af Verslag: Jetze, Hugo en Casper
Poster: Iske en Sanne
4.7 Controle verslag en posterpresentatie

Presentatie en inleveren School 18-06
Verslag en poster def. af
20-06 Gezamenlijk
Inleveren verslag: Hugo
Presentatie: Sanne en Iske
5.2. Strokenplanning
Week 3.7

Week 3.8
Week 3.9
Week 3.10
Week 4.1


6. Literatuurlijst

[1] K. Chikuni, R. Tanabe, S. Muroya, K. Shibata, J. Yamada, Y. Shinmura T. Matsunag, “A quick and simple method for the identification of meat species and meat products by PCR assay,” Dictaat 1457 practicum moleculaire biologie, Januari 2014.
[2] Trouw. (2011, Oktober) De verdieping Trouw. [Online]. http://www.trouw.nl/tr/nl/4504/Economie/article/detail/2975441/2011/10/19/Fraude-met-vangstcijfers-blauwvintonijn.dhtml

[3] GoeieVis.nl. (2010) Tonijn Wijzer. [Online]. http://www.goedevis.nl/project/userfiles/TONIJNwijzer_GoedeVIS_StichtingDeNoordzee.pdf

[4] GoedeVis.nl. (2010) Viswijzer. [Online]. http://www.goedevis.nl/tonijnen/geelvintonijn-msc

[5] GoedeVis.nl. (2010) Viswijzer. [Online]. http://www.goedevis.nl/tonijnen/grootoogtonijn-atlantischeoceaan-longline

[6] Fishbase. (2010) Fishbase. [Online]. http://www.fishbase.org/summary/Thunnus-obesus.html

[7] IUCN Global Species Programme Red List Unit. (2013) iucnredlist. [Online]. http://www.iucnredlist.org/details/170341/0

[8] Erfocentrum. (2014, Januari) Alles over DNA: DNA. [Online]. http://www.allesoverdna.nl/woordenboek/dna.html

[9] Pregenius B.V. (2014, Januari) Verklarende woordenlijst Genetica. [Online]. http://www.pregenius.nl/woordenlijst.html

[10] Erfocentrum. (2014, Januari) Alles over DNA: Dubbele helix. [Online]. http://www.allesoverdna.nl/woordenboek/dubbele-helix.html

[11] Contexo. (2009, Juli) What are Primers? And Why Do We care? [Online]. http://www.contexo.info/DNA_Basics/Primers.htm

[12] Saxion, Life Science, Engineering & Design Propedeuse, “Isolatie van DNA uit kalfsthymus,” Praktijkbundel 1449: Experimenteren 3 BML, Januari 2014.
[13] SciVerse ScienceDirect. Food Chemistry. [Online]. http://www.gbcbiotech.com/genomicaypesca/documentos/identidad%20y%20trazabilidad/Identification%20of%20tuna%20species%20by%20a%20real-time%20polymerase%20chain%20reaction%20technique.pdf

[14] Erfocentrum. (2014, januari) Alles over DNA: PCR. [Online]. http://www.allesoverdna.nl/woordenboek/pcr.html

[15] Saxion, Life Science, Engineering & Design Propedeuse, “PCR,” Practicum Moleculaire Biologie, pp. 21, 22, Januari 2014.
[16] Saxion, Life Science, Engineering & Design Propedeuse, “Zuiverheidsbepaling van geisoleerd DNA uit kalfsthymus,” Praktijkbundel 1449: Experimenteren 3 BML, 2014.
[17] Cold Spring Harbor Laboratory. (2014) Isolate DNA from Plant, Fungal, or Animal Samples. [Online]. http://www.dnabarcoding101.org/protocol_isolating_dna.html

[18] PREMIER Biosoft. PCR Primer Design Guidelines. [Online]. http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html

[19] Fishbase. (2010) Fishbase.org. [Online]. http://www.fishbase.org/photos/thumbnailssummary.php?ID=145

[20] Encyclopedia of Life. (2014) Encyclopedia of Life. [Online]. http://eol.org/pages/214754/overview

[21] Wikipedia.org. (2014) Wikipedia. [Online]. http://en.wikipedia.org/wiki/File:Polymerase_chain_reaction.svg

[22] Florida State University. (1977) Fish DNA ID. [Online]. http://www.fishdnaid.com/

Bijlage I: Protocollen
Protocol: DNA isolatie uit visweefsel (eerste methode)

Benodigdheden
Verschillende soorten vis
0,1 M NaCl/ 0,05M Natriumcitraat buffer
Ethanol 96% (v/v)
Ethanol 70% (v/v)
NaCl (s)
Blender
Potter-Elvejhem potter
Werkwijze: [12]
Zorg bij de isolatie van DNA dat er zoveel mogelijk gewerkt wordt met gekoelde
oplossingen!

Weeg 5,00 g visweefsel af op de analytische balans en noteer het exacte gewicht.
Breng het weefsel over in een Waring Blender.
Homogeniseer het weefsel in ca. 75 mL koude 0,1 M NaCl/0,05 M Na-citraat door gedurende 2 min. te mixen (hoge stand, met tussenpozen, anders wordt het mengsel te warm).
Pak een bak en vul deze met ijs.
Breng het homogenaat over in een grote Potter-Elvejhem buis en plaats deze in de bak met ijs.
Homogeniseer het gekoelde homogenaat verder d.m.v. potteren (in ijs), ca. 5X op en neer te bewegen. Gebruik de roermotor bij ca. 500 rpm.
Verdeel het homogenaat over een aantal grotere centrifugebuizen en centrifugeer 10 min. bij 2600 rpm. Zorg ervoor dat de tegenover elkaar staande buizen gekalibreerd zijn!
Giet het supernatant en het laagje vet, dat boven op de vloeistof ligt, in een vloeiende beweging af in een ruim bekerglas.
Resuspendeer het sediment (de kernen) in een klein volume koele buffer
(ca. 2 mL).
Homogeniseer goed op de vortex.
Vul de buis aan met buffer, kalibreer en centrifugeer direct gedurende 10 min. bij 2600 rpm.
Giet het supernatant af en herhaal punt 9 t/m 11, maar nu met koel demi water. (snel werken).

N.B als het supernatant erg viscues is, dan bevat deze t.g.v. osmotische shock al DNA. Dit gebeurt indien de kernen na het resuspenderen in water te lang staan voordat de oplossing gecentrifugeerd wordt!. Gooi het supernatant nu niet weg.
Experiment gaat door op de volgende pagina.

Resuspendeer het sediment nu in 30 mL demi water.
Breng de suspensie over in een schone Potter-buis en beweeg de potterbuis een aantal keren op en neer, met de hand of evt. met de roermotor.
Breng de oplossing over in een bekerglas van 250 mL en verwijder eventuele klontjes m.b.v. een roerstaaf.
Voeg 4,15 g vast NaCl toe en los dit op. De eindconcentratie NaCl is nu 2,5 M.
Voeg nu voorzichtig 60 mL ethanol 96% toe, zodat de alcohollaag boven op de waterige DNA-oplossing komt te liggen.
Meng de ethanol m.b.v. een glasstaaf met de DNA in oplossing en wind tegelijkertijd de gevormde DNA-draden om de glasstaaf. Pers nu zoveel mogelijk vocht uit het DNA.
Spoel de glasstaaf, met daarom heen het DNA, af met 70% ethanol van kamertemperatuur en breng het DNA over in een schoon bekerglaasje.
Droog het DNA in een stoof en bepaal het gewicht van het DNA. N.B. raak het DNA niet aan met je handen (alleen met plastic handschoenen).

Protocol: DNA isolatie uit visweefsel (tweede methode)

Benodigdheden
Lysis-oplossing (6M Guanidine Hydrochloride GuHCL, 700 ??L)
‘Silica resin’ (10 ??L)
Vis monster
‘Was buffer’ (2,5 mL)
Hondenbak met ijs
Centrifuge
Waterbad of verwarmingselement op 65 ??C en 57 ??C
Vortex
Knikkers
Werkwijze: [17]

Neem ~10-20 mg vismonster.
Plaats het monster in een centrifugebuis en voorzie deze van duidelijke codering.
Voeg 300 ??L van de Lysis-oplossing toe aan iedere centrifugebuis.
Maak het monster kapot, door m.b.v. een glazen roerstaafje het monster tegen de binnenkant van de centrifugebuis te wrijven, +/- 1 minuut.
Gebruik per nieuw epje een nieuw/schoon
Incubeer de centrifugebuizen in een waterbad bij 65 ??C gedurende 10 minuten.
Centrifugeer de centrifugebuizen gedurende 1 minuut op 2600 rpm.
Breng het supernatant (heldere vloeistof, zonder pellet) over naar een nieuwe centrifugebuis. N.B. Let op dat het pellet niet mee spoelt.
Voeg 3 ??L Silica resin toe aan de centrifugebuis, homogeniseer door in en uit te pipetteren. Incubeer vervolgens de afgesloten centrifugebuis gedurende 5 minuten in een waterbad bij 57 ??C.
Plaats de centrifugebuizen in de centrifuge, centrifugeer 30 seconden op 2600 rpm. Pipetteer voorzichtig de vloeistof boven het pellet weg.
Voeg 500 ??L ijskoude ‘Was buffer’ toe aan het pellet. Homogeniseer de inhoud goed. (Door te vortexen of op en neer te pipetteren.)
Centrifugeer andermaal de buis met inhoud, gedurende 30 seconden op 2600 rpm. Verwijder het supernatant (de heldere vloeistof) met een pipetman. N.B. Let erop niet het pellet te verstoren en mee te nemen.
Voeg wederom 500 ??L van de ijskoude ‘Was buffer’ aan het pellet toe. Homogeniseer de inhoud goed. (Door te vortexen of op en neer te pipetteren.)
Centrifugeer wederom de centrifugebuis gedurende 30 seconden bij 2600 rpm.
Pipetteer het supernatant (de heldere vloeistof) af zonder het pellet te verstoren.
Voeg 100 ??L demiwater toe aan het ‘Silica resin’ en homogeniseer goed. (Door te vortexen of op en neer te pipetteren.)
Incubeer de centrifugebuis gedurende 5 minuten op 57 ??C.
Centrifugeer andermaal gedurende 30 seconden op 2600 rpm om het ‘Silica resin’ in het pellet te krijgen.
Breng 90 ??L van het supernatant (heldere vloeistof) over naar een nieuwe centrifugebuis.
N.B. Let op dat het pellet niet verstoord wordt. (& gooi de buis met pellet weg)
Het monster (90 ??L) is nu klaar. Bewaren bij -20??C.
(Om de mate van denaturatie en enzymactiviteit te verminderen.)’
Protocol: Zuiverheid bepaling van ge??soleerd DNA uit visweefsel

Benodigdheden:
DNA ge??soleerd uit visweefsel
UV-cuvetten
Spectrofotometer
Werkwijze: [16]

Los 0,5 g visweefsel DNA op in 100 mL demiwater (dit duurt ongeveer een uur).
Maak de volgende verdunning in demiwater (per verdunning 5 mL):
visweefsel DNA (0,05 mg/mL)
Neem absorptiespectra op van ?? = 230 tot 350 nm.
Meet de extinctie bij zowel E260, E280 en E320. (?? = 260; 280; 320 nm)
Bepaal de zuiverheid en concentratie van de DNA monsters.
Bereken de concentratie en de zuiverheid van het ge??soleerde DNA door E260/E280. Voor zuiver DNA geldt dat de ratio tussen de 1,8 en 2,0 ligt.


Protocol: Polymerase Ketting Reactie (PCR)

Benodigdheden:
Primer ‘Grootoogtonijn’ (Forward en Reverse)
Primer ‘Pacifische Blauwvintonijn’ (Forward en Reverse)
Primer ‘Zuidelijke Blauwvintonijn’ (Forward en Reverse)
Primer ‘Geelvintonijn’ (Forward en Reverse)
Primer ‘Algemeen tonijn’ (Forward en Reverse)
Analytische balans
PCR BioRad-apparatuur
Verkregen vis-DNA
Tris-acetaat
EDTA
Agarose gel
Ethidiumbromide

Werkwijze: [1,14]

Zorg voor 50 mL 10 mM Tris-oplossing
De primers worden gemengd in de verhoudingen 1:1:1:1:1* voor de primers: ‘Grootoogtonijn’ : ‘Pacifische Blauwvintonijn’ : ‘Zuidelijke Blauwvintonijn’ : ‘Geelvintonijn’ : ‘Algemeen tonijn’.
* Ratio 1 staat voor 20 pmol (pico=10-12) primer/50 ‘L PCR oplossing.
25 cycli moeten plaatsvinden m.b.v. de PCR BioRad-apparatuur:
Denatureer bij 94 ‘C voor 0.5 min.
Annealing bij 60 ‘C voor 0.5 min.
En verleng bij 72 ‘C voor 0.5 min.
Zorg dat de omgeving een pH van 8.0 heeft, [“Tris-acetaat” ] = 40 mM en
[“EDTA” ] = 1 mM
Brengt 8 ‘L PCR-oplossing aan op de agarosegel en breng aan op het BioRad-apparaat.
Elektroforeer voor 30 min bij 100 V.
Na afloop van de elektroforese wordt kleuring toegepast door middel van ethidiumbromide (0,5 ‘g ‘ mL-1) toe te voegen.

Bijlage II: Veiligheidsformulieren
ALGEMENE INFORMATIE VAN DE STOF
Naam stof / soort monster: Bovine serum Albumine EDTA

DATA MET BETREKKING TOT OPLOSBAARHEID
Oplosbaarheid: 40 mg/mL oplosbaar in koud water

DATA MET BETREKKING TOT BRANDBAARHEID/EXPLOSIVITEIT
Vlampunt N.v.t. N.v.t.
Zelfontbrandingtemperatuur N.v.t. N.v.t.
Explosiegrenzen N.v.t. N.v.t.
Blusmiddel

bluspoeder, CO2, waternevel of schuim klein vuur: droog chemisch poeder groot vuur: water spray, nevel of schuim. gebruik geen water jet

‘DATA MET BETREKKING TOT TOXICITEIT
MAC-waarde N.v.t. N.v.t.
LD50/LC50-waarde N.v.t. rat meer dan 2000 mg/kg
Carcinogeniteit N.v.t. N.v.t.
Reprotoxiciteit N.v.t. N.v.t.
Reukgrens N.v.t. N.v.t.
R&S zinnen

S24/25 N.v.t.
Persoonlijke bescherming

handschoenen, bril en labjas bril, handschoenen en labjas
Afvalverwerking
Categorie: 3

Halogeenarme organische afvalstoffen
Categorie: 3

Halogeenarme organische afvalstoffen

Biologisch afvalverwerking
ALGEMENE INFORMATIE VAN DE STOF
Naam stof / soort monster: Saline Sodium Citrate 20X Solution ethanol 70%

DATA MET BETREKKING TOT OPLOSBAARHEID
Oplosbaarheid: Oplosbaar volledig oplosbaar

DATA MET BETREKKING TOT BRANDBAARHEID/EXPLOSIVITEIT
Vlampunt N.v.t. losed cup PM 24 0C
Zelfontbrandingtemperatuur N.v.t. N.v.t.
Explosiegrenzen N.v.t. 3,4-19 vol%
Blusmiddel

Klein vuur: droog chemisch poeder Groot vuur: water spray, CO2,droog chemisch poeder, of een geschikt schuim Poeder, alcoholbestendig schuim, zeer veel water, koolzuur.
Vaten en tanks in de omgeving koelen met water.

‘DATA MET BETREKKING TOT TOXICITEIT
MAC-waarde N.v.t. 1000 mg/m3
LD50/LC50-waarde Oral, mouse: LD50 = 4 gm/kg;Oral, rat: LD50 = 3000 mg/kg; Skin, rabbit: LD50 = >10 gm/kg; Inademing (acuut): LC 50 rat – 20000 ppm/10h
LC 50 rat – > 8000 mg/1/4h
Inslikken (acuut): LD 50 rat – 6200 ‘ 17800 mg/kg
LD Lo mens – 1430 mg/kg
Huid (acuut): LD 50 konijn – >20000 mg/kg
Carcinogeniteit N.v.t. N.v.t.
Reprotoxiciteit N.v.t. N.v.t.
Reukgrens N.v.t. karakteristieke geur
R&S zinnen

S24/25 contact met ogen en huid vermijden R-11: licht ontvlambaar
S-zinnen: S2 buiten bereik van kinderen bewaren
S7: in goed gesloten verpakking bewaren
S16: verwijderd houden van ontstekingsbronnen
Persoonlijke bescherming

Bril, handschoenen en labjas
Geschikte bril, handschoenen en labjas
Afvalverwerking
Categorie: 4

halogeenrijke organische afvalstoffen Categorie: 3

Halogeenarme organische afvalstoffen

Biologisch afvalverwerking

ALGEMENE INFORMATIE VAN DE STOF
Naam stof / soort monster: ethanol 96% Ethidiumbromide

DATA MET BETREKKING TOT OPLOSBAARHEID
Oplosbaarheid: kan met water vermengd worden gedeeltelijk oplosbaar in koud water

DATA MET BETREKKING TOT BRANDBAARHEID/EXPLOSIVITEIT
Vlampunt N.v.t. N.v.t.
Zelfontbrandingtemperatuur N.v.t. N.v.t.
Explosiegrenzen 3,5/15 vol.% N.v.t.
Blusmiddel

water, koolstofdioxide, schuim, droog poeder gebruik droog chemisch poeder groot vuur: gebruik water spray,nevel of schuim. gebruik geen water jet.

‘DATA MET BETREKKING TOT TOXICITEIT
MAC-waarde 1000 mg/m3 N.v.t.
LD50/LC50-waarde DD50 oraal rat: 7060 mg/kg rat inademen 0,0472 mg/l
Carcinogeniteit N.v.t. wel carcinogeen
Reprotoxiciteit N.v.t. mogelijk
Reukgrens kenmerkende geur N.v.t.
R&S zinnen

R11 – Highly flammable.
R40 – Possible risks of irreversible effects.
R66 – Repeated exposure may cause skin dryness and cracking.
R20/22 – Harmful by inhalation and if swallowed.
R36/38 – Irritating to eyes and skin.

Safety Phrase(s)
S7 – Keep container tightly closed.
S16 – Keep away from sources of ignition – No smoking.
S23 – Do not breathe vapour.
S29 – Do not empty into drains.
S33 – Take precautionary measures against static discharges.
S45 – In case of accident or if you feel unwell seek medical advice immediately (show the label whenever
possible)
S24/25 – Avoid contact with skin and eyes
S36/37/39 – Wear suitable protective clothing/ gloves and eye/face protection R23 giftig door inademen R68 mogelijk risico op onomkeerbare effecten S24/25 vermijdt contact met ogen en huid S26 in geval van contact met ogen, wassen met voldoende water en medische hulp zoeken S28A na contact met de huid, gelijk wassen met voldoende water
Persoonlijke bescherming
geschikte bril gebruiken, geschikte handschoenen gebruiken, een labjas labjas, bril en handschoenen
Afvalverwerking

Categorie: 3

Halogeenarme organische afvalstoffen Categorie: 4

halogeenrijke organische afvalstoffen
Biologisch afvalverwerking

ALGEMENE INFORMATIE VAN DE STOF
Naam stof / soort monster: potassiumchloride (KCl) Magnesiumchloride (MgCl)

DATA MET BETREKKING TOT OPLOSBAARHEID
Oplosbaarheid: oplosbaar in koud en warm water oplosbaar in water

DATA MET BETREKKING TOT BRANDBAARHEID/EXPLOSIVITEIT
Vlampunt N.v.t. N.v.t.
Zelfontbrandingtemperatuur N.v.t. N.v.t.
Explosiegrenzen N.v.t. N.v.t.
Blusmiddel

de stof is niet brandbaar, gebruik blusmiddelen die geschikt zijn voor de omgeving voor omgeving geschikt

‘DATA MET BETREKKING TOT TOXICITEIT
MAC-waarde
LD50/LC50-waarde LD50:2600 mg/kg bij rat oraal, LD50: 1500 mg/kg bij muis oraal LD50: muis oraal 4700 mg/kg LD50: rat oraal 2800 mg/kg
Carcinogeniteit N.v.t. N.v.t.
Reprotoxiciteit N.v.t. N.v.t.
Reukgrens zeer zwakke geur N.v.t.
R&S zinnen

R36: irriterend voor de ogen S26: in geval van contact met de ogen, meten goed spoelen en medische hulp zoeken S39: draag oog/gezichts bescherming N.v.t.
Persoonlijke bescherming

basisbescherming handschoenen, bril en labjas

Afvalverwerking

Categorie: 4

halogeenrijke organische afvalstoffen Categorie: 4

halogeenrijke organische afvalstoffen
Biologisch afvalverwerking

ALGEMENE INFORMATIE VAN DE STOF
Naam stof / soort monster: Natriumchloride (NaCl) TRIS acetaat

DATA MET BETREKKING TOT OPLOSBAARHEID
Oplosbaarheid: makkelijk oplosbbar in koud of warm water, oplosbaar in glycerol en ommoniak. zeer licht oplosbaar in alcohol. oplosbaar in water

DATA MET BETREKKING TOT BRANDBAARHEID/EXPLOSIVITEIT
Vlampunt N.v.t. N.v.t.
Zelfontbrandingtemperatuur N.v.t. N.v.t.
Explosiegrenzen N.v.t. N.v.t.
Blusmiddel

voor omgeving geschikt voor omgeving geschikt

‘DATA MET BETREKKING TOT TOXICITEIT
MAC-waarde
LD50/LC50-waarde Acute oral toxicity (LD50): 3000 mg/kg [Rat.]. Acute dermal toxicity (LD50): >10000 mg/kg [Rabbit]. Acute toxicity of the dust (LC50): >42000 mg/m3 1 hours [Rat]. LD50: konijn oraal 2300 mg/kg LD50: oraal rat 2000 mg/kg
Carcinogeniteit N.v.t. N.v.t.
Reprotoxiciteit N.v.t. N.v.t.
Reukgrens zwakke geur N.v.t.
R&S zinnen

R:- S:24/25 vermijd contact met ogen en huid N.v.t.
Persoonlijke bescherming

bril, labjas, handschoenen basis bescherming
Afvalverwerking

Categorie: 4

halogeenrijke organische afvalstoffen Categorie: 3

Halogeenarme organische afvalstoffen
Biologisch afvalverwerking

About Essay Marketplace

Essay Marketplace is a library of essays for your personal use as examples to help you write better work.

...(download the rest of the guide above)

About this guide:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Marketplace, Dissertation: Een methode ontwikkelen en te optimaliseren om tonijnsoorten aan te tonen m.b.v. DNA analyse. Available from:<https://www.essaymarketplace.com/dutch-essays/essay-een-methode-ontwikkelen-en-te-optimaliseren-om-tonijnsoorten-aan-te-tonen-m-b-v-dna-analyse/> [Accessed 11-07-20].

Review this guide:

Please note that the above text is only a preview of this guide.

Name
Email
Review Title
Rating
Review Content

Latest reviews:

Leave a Comment

Time limit is exhausted. Please reload the CAPTCHA.